Fgf9 (NM_013518) Mouse Untagged Clone

CAT#: MC208493

Fgf9 (untagged) - Mouse fibroblast growth factor 9 (Fgf9), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fgf9
• Synonyms: Eks
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208493 representing NM_013518
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTCCCTTAGGTGAAGTTGGGAGCTATTTCGGTGTGCAGGACGCGGTACCGTTCGGGAACGTACCGG
  TGTTGCCGGTGGACAGTCCGGTGTTGCTAAGTGACCACCTGGGTCAGTCCGAAGCAGGGGGGCTGCCCCG
  GGGCCCCGCAGTCACGGACTTGGATCATTTAAAGGGGATTCTCAGGCGGAGGCAGCTGTACTGCAGGACT
  GGATTTCATTTAGAGATCTTCCCCAACGGTACTATCCAGGGAACCAGGAAAGACCACAGCCGCTTCGGCA
  TTCTGGAATTTATCAGTATAGCAGTGGGCCTGGTCAGCATTCGCGGTGTGGACAGTGGACTCTACCTCGG
  CATGAACGAGAAGGGGGAGCTGTATGGATCAGAAAAACTAACACAGGAATGTGTGTTCAGAGAACAGTTT
  GAAGAGAACTGGTACAACACCTACTCTTCCAACCTCTATAAACATGTGGACACCGGAAGGAGATACTATG
  TTGCATTAAATAAGGACGGGACTCCAAGAGAAGGGACCAGGACTAAACGGCACCAGAAATTTACACATTT
  TTTACCTAGACCAGTGGACCCTGACAAAGTACCTGAACTATATAAGGATATTCTAAGCCAAAGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_013518
• ORF Size: 627 bp
• Insert Size: 627
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC099875, AAH99875
• RefSeq Size: 816
• RefSeq ORF: 627
• Locus ID: 14180
• Gene Summary: Plays an important role in the regulation of embryonic development, cell proliferation, cell differentiation and cell migration. May have a role in glial cell growth and differentiation during development, gliosis during repair and regeneration of brain tissue after damage, differentiation and survival of neuronal cells, and growth stimulation of glial tumors. [UniProtKB/Swiss-Prot Function]