Fut2 (NM_018876) Mouse Untagged Clone

CAT#: MC208513

Fut2 (untagged) - Mouse fucosyltransferase 2 (Fut2), (10ug)


  "NM_018876" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Fut2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fut2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208513 representing NM_018876
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGAGTGCCCAGGTACCTTTCTCCTTTCCTCTGGCCCACTTCCTCATCTTTGTCTTTGTGACTTCCA
CCATCATCCACCTCCAGCAACGAATAGTGAAGCTCCAAACCCTGTCAGAGAAGGAATTACAGGCGGTTCA
AATGTCCTCACCAAACGCGGCAAGAACAGACATGCAGCAGAGTGCCAAGCTGCAGGGCATATTCACGATC
AATTCCATCGGCCGCCTGGGGAACCAGATGGGCGAATATGCTACATTGTTTGCACTGGCCAGGATGAACG
GTCGGCTTGCCTTCATCCCTGAATCCATGCACAACGCTCTAGCGCCCATCTTCAGGATCAGTCTCCCGGT
GTTACACAGCGACACAGCCAGAAGGATCCCGTGGCAGAATTACCACCTCAACGACTGGATGGAGGAGCGT
TACCGCCACATCCCGGGGCAGTATGTGCGTTTCACGGGATACCCGTGCTCCTGGACCTTCTACCACCACC
TGCGCCCAGAGATCCTGAAGGAGTTCACCCTGCACGACCATGTGCGTGAGGAGGCCCAGGCTTTCCTGCG
TGGCCTGCGGGTGAATGGGAGCCAGCCGAGTACCTTTGTGGGTGTCCATGTGCGCCGAGGGGACTATGTG
CATGTCATGCCCAAGGTGTGGAAGGGCGTGGTGGCTGACCGGGGTTACCTAGAAAAGGCCCTGGACAGGT
TCCGGGCACGCTATTCATCTCCAGTCTTCGTGGTTACAAGCAACGGTATGGCCTGGTGCCGGGAGAACAT
CAACACCTCCCTAGGAGACGTGGTGTTTGCGGGCAATGGTATTGAGGGCTCACCAGCCAAGGACTTCGCG
CTCCTCACCCAGTGCAACCACACCATCATGACCATTGGAACCTTTGGGATTTGGGCTGCCTACCTGGCAG
GTGGTGATACCATCTACCTAGCCAACTACACCCTTCCGGATTCTCCGTTCCTCAAAATCTTTAAGCCAGC
AGCAGCCTTCCTCCCCGAGTGGATGGGCATCCCCGCAGACCTGTCCCCACTCCTTAAGCACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_018876
ORF Size 1044 bp
Insert Size 1044
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_018876.4, NP_061364.2
RefSeq Size 2969
RefSeq ORF 1044
Locus ID 14344
Gene Summary This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.