Gip (NM_008119) Mouse Untagged Clone

CAT#: MC208552

Gip (untagged) - Mouse gastric inhibitory polypeptide (Gip), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gip
• Synonyms: MGC129268; MGC129269
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208552 representing NM_008119
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGTGGCTTTGAAGACCTGCTCTCTGTTGCTGGTGCTCCTGTTCCTGGCTGTCGGGCTGGGAGAAAAAG
  AAGAGGTTGAGTTCCGATCCCATGCTAAATTTGCTGGCCCTCGACCTCGAGGTCCAAGGTACGCAGAGGG
  GACTTTCATCAGTGATTACAGCATCGCCATGGACAAGATCCGACAACAAGACTTCGTGAACTGGCTGCTG
  GCACAGAGGGGGAAGAAGAGTGACTGGAAACACAACATCACCCAGAGAGAGGCCCGGGCTTTGGTGCTGG
  CAGGGCAATCTCAGGGAAAGGAGGACAAAGAGGCACAGGGGAGCTCGTTGCCCAAGAGCCTCAGTGATGA
  TGATGTGCTGAGAGACCTTCTGATTCAAGAGCTACTGGCCTGGATGGTGGACCAAACAGAGCTCTGCCGA
  CTCAGGTCTCAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_008119
• ORF Size: 435 bp
• Insert Size: 435
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC104314, AAI04315
• RefSeq Size: 649
• RefSeq ORF: 435
• Locus ID: 14607
• Gene Summary: This gene encodes an incretin hormone that belongs to the glucagon superfamily. The encoded preproprotein undergoes proteolytic processing to generate mature peptides that function as potent stimulators of insulin secretion and inhibit gastric acid secretion. Transgenic mice overexpressing the encoded protein exhibit a significant increase in the expression of markers of bone formation, a decrease in the expression of markers of bone resorption and, an increase in the bone mass. [provided by RefSeq, Nov 2015]