Gng8 (NM_010320) Mouse Untagged Clone

CAT#: MC208573

Gng8 (untagged) - Mouse guanine nucleotide binding protein (G protein), gamma 8 (Gng8), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gng8
• Synonyms: G(y)8
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208573 representing NM_010320
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCCAACAACATGGCCAAGATTGCTGAGGCCCGCAAGACCGTGGAGCAGCTGAAGCTGGAAGTGAACA
  TCGATCGCATGAAGGTGTCGCAGGCAGCAGCCGAGCTTTTGGCTTTCTGCGAAACGCACGCTAAGGATGA
  CCCACTGGTGACTCCTGTCCCTGCCGCCGAGAATCCCTTCCGCGACAAGCGACTCTTTTGCACCCTGCTC
  TGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010320
• ORF Size: 213 bp
• Insert Size: 213
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_010320.3, NP_034450.1
• RefSeq Size: 920
• RefSeq ORF: 213
• Locus ID: 14709
• Gene Summary: Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction. This subunit may have a very specific role in the development and turnover of olfactory and vomeronasal neurons. [UniProtKB/Swiss-Prot Function]