H2 (NM_010381) Mouse Untagged Clone

CAT#: MC208624

H2 (untagged) - Mouse histocompatibility 2, class II antigen E alpha, pseudogene (H2-Ea-ps), (10ug)


  "NM_010381" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol H2
Synonyms AI323765; E-alpha-f; H-2Ea; H2-Ea; I-Ealpha; Ia-3; Ia3; MHC-H2-Ea
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208624 representing NM_010381
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCACAATTGGAGCCCTGCTGTTAAGATTTTTCTTCATTGCTGTTCTGATGAGCTCCCAGAAGTCAT
GGGCTATCAAAGAGGAACACACCATCATCCAGGCGGAGTTCTATCTTTTACCAGACAAACGTGGAGAGTT
TATGTTTGACTTTGACGGCGATGAGATTTTCCATGTAGACATTGAAAAGTCAGAGACCATCTGGAGACTT
GAAGAATTTGCAAAGTTTGCCAGCTTTGAGGCTCAGGGTGCACTGGCTAATATAGCTGTGGACAAAGCTA
ACCTGGATGTCATGAAAGAGCGTTCCAACAACACTCCAGATGCCAACGTGGCCCCAGAGGTGACTGTACT
CTCCAGAAGCCCTGTGAACCTGGGAGAGCCCAACATCCTCATCTGTTTCATTGACAAGTTCTCCCCTCCA
GTGGTCAATGTCACCTGGTTCCGGAATGGACGGCCTGTCACCGAAGGCGTGTCAGAGACAGTGTTTCTCC
CGAGGGACGATCACCTCTTCCGCAAATTCCACTATCTGACCTTCCTGCCCTCCACAGATGATTTCTATGA
CTGTGAGGTGGATCACTGGGGTTTGGAGGAGCCTCTGCGGAAGCACTGGGAGTTTGAAGAGAAAACCCTC
CTCCCAGAAACTACAGAGAATGTCGTGTGTGCTCTTGGGTTGTTTGTGGGTCTGGTGGGCATCGTTGTGG
GGATTATCCTCATCATGAAGGGTATTAAAAAACGCAATGTTGTAGAACGCCGACAAGGAGCCCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010381
ORF Size 768 bp
Insert Size 768
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_010381.2, NP_034511.2
RefSeq Size 887
RefSeq ORF 768
Locus ID 100504404
Gene Summary This locus belongs to the class II major histocompatibility complex (MHC) family of genes, which encode immune response (Ia) antigens that function in the T-cell-dependent immune response. This family member has multiple haplotypes, some of which result in the production of an E-alpha subunit that combines with an E-beta subunit to form a functional E complex at the cell surface. Other haplotypes, including that of the reference genome allele, contain mutations and they thus represent polymorphic pseudogenes that do not produce functional products. These mutations include frameshifting indels, nonsense mutations, and deletions of larger regions. The reference genome haplotype contains a deletion at the 5' end of the gene, including the core promoter region and the transcription start site, and therefore no transcripts result from this haplotype. [provided by RefSeq, Aug 2011]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.