Hbb (NM_008220) Mouse Untagged Clone

CAT#: MC208650

Hbb (untagged) - Mouse hemoglobin, beta adult major chain (Hbb-b1), (10ug)


  "NM_008220" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hbb
Synonyms Beta-t
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208650 representing NM_008220
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGTCTCTGGCCTGTGGGGAAAGGTGAACGCCGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTTGTCTACCCTTGGACCCAGCGGTACTTTGATAGCTTTGG
AGACCTATCCTCTGCCTCTGCTATCATGGGTAATGCCAAAGTGAAGGCCCATGGCAAGAAAGTGATAACT
GCCTTTAACGATGGCCTGAATCACTTGGACAGCCTCAAGGGCACCTTTGCCAGCCTCAGTGAGCTCCACT
GTGACAAGCTGCATGTGGATCCTGAGAACTTCAGGCTCCTGGGCAATATGATCGTGATTGTGCTGGGCCA
CCACCTGGGCAAGGATTTCACCCCCGCTGCACAGGCTGCCTTCCAGAAGGTGGTGGCTGGAGTGGCTGCT
GCCCTGGCTCACAAGTACCACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008220
ORF Size 444 bp
Insert Size 444
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_008220.5, NP_032246.2
RefSeq Size 646
RefSeq ORF 444
Locus ID 101488143
Gene Summary This gene encodes a beta polypeptide chain found in adult hemoglobin, which consists of a tetramer of two alpha chains and two beta chains, and which functions in the transport of oxygen to various peripheral tissues. This gene is one of a cluster of beta-hemoglobin genes that are distally regulated by a locus control region, and which are organized along the chromosome in the order of their developmental expression. In mouse, two major strain-specific haplotypes of the beta-globin gene cluster are found - a "single" haplotype found in C57BL/-type strains, which includes two highly similar adult beta-globin genes, beta s and beta t, and a "diffuse" haplotype found in strains such as BALB/c and 129Sv, which includes two somewhat diverse adult beta-globin genes, beta-major and beta-minor. This gene represents the beta t adult gene found in the "single" haplotype. Primary chromosome 7 of the mouse reference genome assembly, which is derived from C57BL/6 strain mice, represents the "single" haplotype, while the "diffuse" haplotype is represented in the reference genome collection by the BALB/c strain alternate contig, NT_095534.1. [provided by RefSeq, May 2013]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.