Hist2h2aa1 (NM_013549) Mouse Untagged Clone

CAT#: MC208664

Hist2h2aa1 (untagged) - Mouse histone cluster 2, H2aa1 (Hist2h2aa1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Hist2h2aa1
• Synonyms: AI448581; H2a-614; H2a-615; Hist2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208664 representing NM_013549
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCCGGTCGTGGCAAGCAAGGAGGCAAGGCCCGCGCCAAGGCCAAGTCGCGGTCTTCCCGGGCCGGGC
  TACAGTTCCCGGTGGGGCGTGTGCACCGGCTGCTGCGCAAGGGCAACTACGCGGAGCGTGTGGGTGCCGG
  CGCGCCGGTATACATGGCGGCGGTGCTGGAGTACCTAACGGCCGAGATCCTGGAGCTGGCGGGCAACGCG
  GCCCGCGACAACAAGAAGACGCGCATCATCCCGCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGC
  TCAACAAGCTGCTGGGCAAAGTGACGATCGCGCAGGGCGGCGTCCTGCCCAACATCCAGGCCGTGCTGCT
  GCCCAAGAAGACGGAGAGCCACCATAAGGCGAAGGGCAAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_013549
• ORF Size: 393 bp
• Insert Size: 393
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_013549.2, NP_038577.1
• RefSeq Size: 556
• RefSeq ORF: 393
• Locus ID: 15267
• Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. [provided by RefSeq, Oct 2015]