Ifnb1 (NM_010510) Mouse Untagged Clone

CAT#: MC208751

Ifnb1 (untagged) - Mouse interferon beta 1, fibroblast (Ifnb1), (10ug)


  "NM_010510" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Ifnb1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ifnb1
Synonyms Ifb; IFN-beta; IFNB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_010510, the custom clone sequence may differ by one or more nucleotides


ATGAACAACAGGTGGATCCTCCACGCTGCGTTCCTGCTGTGCTTCTCCACCACAGCCCTCTCCATCAACT
ATAAGCAGCTCCAGCTCCAAGAAAGGACGAACATTCGGAAATGTCAGGAGCTCCTGGAGCAGCTGAATGG
AAAGATCAACCTCACCTACAGGGCGGACTTCAAGATCCCTATGGAGATGACGGAGAAGATGCAGAAGAGT
TACACTGCCTTTGCCATCCAAGAGATGCTCCAGAATGTCTTTCTTGTCTTCAGAAACAATTTCTCCAGCA
CTGGGTGGAATGAGACTATTGTTGTACGTCTCCTGGATGAACTCCACCAGCAGACAGTGTTTCTGAAGAC
AGTACTAGAGGAAAAGCAAGAGGAAAGATTGACGTGGGAGATGTCCTCAACTGCTCTCCACTTGAAGAGC
TATTACTGGAGGGTGCAAAGGTACCTTAAACTCATGAAGTACAACAGCTACGCCTGGATGGTGGTCCGAG
CAGAGATCTTCAGGAACTTTCTCATCATTCGAAGACTTACCAGAAACTTCCAAAACTGA


Restriction Sites SgfI-MluI     
ACCN NM_010510
ORF Size 549 bp
Insert Size 549
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC119395, AAI19396
RefSeq Size 615
RefSeq ORF 549
Locus ID 15977
Gene Summary Has antiviral, antibacterial and anticancer activities. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.