Igf1 (NM_001111275) Mouse Untagged Clone

CAT#: MC208757

Igf1 (untagged) - Mouse insulin-like growth factor 1 (Igf1), transcript variant 4, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Igf1
• Synonyms: C730016P09Rik; Igf-1; Igf-I
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NM_001111275.1
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGGAAAATCAGCAGCCTTCCAACTCAATTATTTAAGATCTGCCTCTGTGACTTCTTGAAGATAAAGA
  TACACATCATGTCGTCTTCACACCTCTTCTACCTGGCGCTCTGCTTGCTCACCTTCACCAGCTCCACCAC
  AGCTGGACCAGAGACCCTTTGCGGGGCTGAGCTGGTGGATGCTCTTCAGTTCGTGTGTGGACCGAGGGGC
  TTTTACTTCAACAAGCCCACAGGCTATGGCTCCAGCATTCGGAGGGCACCTCAGACAGGCATTGTGGATG
  AGTGTTGCTTCCGGAGCTGTGATCTGAGGAGACTGGAGATGTACTGTGCCCCACTGAAGCCTACAAAAGC
  AGCCCGCTCTATCCGTGCCCAGCGCCACACTGACATGCCCAAGACTCAGAAGGAAGTACATTTGAAGAAC
  ACAAGTAGAGGAAGTGCAGGAAACAAGACCTACAGAATGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001111275
• ORF Size: 462 bp
• Insert Size: 462
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001111275.1, NP_001104745.1
• RefSeq Size: 7069
• RefSeq ORF: 462
• Locus ID: 16000
• Gene Summary: This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. This gene is predominantly expressed in the liver and the encoded protein undergoes proteolytic processing to generate a disulfide-linked mature polypeptide. Transgenic disruption of this gene in mice results in reduced postnatal survival and severe growth retardation. Mice lacking the encoded protein exhibit generalized organ hypoplasia including underdevelopment of the central nervous system and developmental defects in bone, muscle and reproductive systems. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (4) lacks an alternate frame-shifting exon in the 3' coding region, compared to variant 1, resulting in a protein (isoform 4) with a novel C-terminus, compared to isoform 1. This isoform (4) is also known as IA. Sequence Note: This RefSeq was created from transcript and genomic sequence because transcript sequence consistent with the reference assembly was not available for all regions of the RefSeq transcript. The extent of this transcript is supported by transcript alignments.