Igf2 (NM_010514) Mouse Untagged Clone

CAT#: MC208758

Igf2 (untagged) - Mouse insulin-like growth factor 2 (Igf2), transcript variant 1, (10ug)


  "NM_010514" in other vectors (6)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Igf2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Igf2
Synonyms AL033362; Igf-2; Igf-II; M6pr; Mpr; Peg2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208758 representing NM_010514
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCGGCAGCGTCGCCGGCTTCCAGGTACCAATGGGGATCCCAGTGGGGAAGTCGATGTTGGTGCTTC
TCATCTCTTTGGCCTTCGCCTTGTGCTGCATCGCTGCTTACGGCCCCGGAGAGACTCTGTGCGGAGGGGA
GCTTGTTGACACGCTTCAGTTTGTCTGTTCGGACCGCGGCTTCTACTTCAGCAGGCCTTCAAGCCGTGCC
AACCGTCGCAGCCGTGGCATCGTGGAAGAGTGCTGCTTCCGCAGCTGCGACCTGGCCCTCCTGGAGACAT
ACTGTGCCACCCCCGCCAAGTCCGAGAGGGACGTGTCTACCTCTCAGGCCGTACTTCCGGACGACTTCCC
CAGATACCCCGTGGGCAAGTTCTTCCAATATGACACCTGGAGACAGTCCGCGGGACGCCTGCGCAGAGGC
CTGCCTGCCCTCCTGCGTGCCCGCCGGGGTCGCATGCTTGCCAAAGAGCTCAAAGAGTTCAGAGAGGCCA
AACGTCATCGTCCCCTGATCGTGTTACCACCCAAAGACCCCGCCCACGGGGGAGCCTCTTCGGAGATGTC
CAGCAACCATCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010514
ORF Size 576 bp
Insert Size 576
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_010514.3, NP_034644.2
RefSeq Size 4038
RefSeq ORF 576
Locus ID 16002
Gene Summary This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. It is an imprinted gene that is expressed only from the paternal allele. The encoded protein undergoes proteolytic processing to generate a mature peptide. The transgenic overexpression of this gene in mice results in prenatal overgrowth, polyhydramnios, fetal and neonatal lethality, disproportionate organ overgrowth including tongue enlargement, and skeletal abnormalities. Mice lacking the encoded protein exhibit growth deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). This isoform (1) may undergo proteolytic processing similar to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to extend the N-terminus. The use of an alternative upstream start codon would result in a protein that is 11 aa longer. This upstream AUG has a stronger Kozak signal than the downstream site and and appears to be rodent-specific, but according to the software program SignalP3.0, the 11 additional amino acids are not predicted to disrupt cleavage of the signal peptide.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.