Il18 (NM_008360) Mouse Untagged Clone

CAT#: MC208775

Il18 (untagged) - Mouse interleukin 18 (Il18), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Il18
• Synonyms: Igif; Il-18
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208775 representing NM_008360
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTGCCATGTCAGAAGACTCTTGCGTCAACTTCAAGGAAATGATGTTTATTGACAACACGCTTTACT
  TTATACCTGAAGAAAATGGAGACCTGGAATCAGACAACTTTGGCCGACTTCACTGTACAACCGCAGTAAT
  ACGGAATATAAATGACCAAGTTCTCTTCGTTGACAAAAGACAGCCTGTGTTCGAGGATATGACTGATATT
  GATCAAAGTGCCAGTGAACCCCAGACCAGACTGATAATATACATGTACAAAGACAGTGAAGTAAGAGGAC
  TGGCTGTGACCCTCTCTGTGAAGGATAGTAAAATGTCTACCCTCTCCTGTAAGAACAAGATCATTTCCTT
  TGAGGAAATGGATCCACCTGAAAATATTGATGATATACAAAGTGATCTCATATTCTTTCAGAAACGTGTT
  CCAGGACACAACAAGATGGAGTTTGAATCTTCACTGTATGAAGGACACTTTCTTGCTTGCCAAAAGGAAG
  ATGATGCTTTCAAACTCATTCTGAAAAAAAAGGATGAAAATGGGGATAAATCTGTAATGTTCACTCTCAC
  TAACTTACATCAAAGTTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_008360
• ORF Size: 579 bp
• Insert Size: 579
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC024384, AAH24384
• RefSeq Size: 876
• RefSeq ORF: 579
• Locus ID: 16173
• Gene Summary: Augments natural killer cell activity in spleen cells and stimulates interferon gamma production in T-helper type I cells. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 both encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.