Il6 (NM_031168) Mouse Untagged Clone

CAT#: MC208786

Il6 (untagged) - Mouse interleukin 6 (Il6), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Il6
• Synonyms: Il-6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208786 representing NM_031168
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGTTCCTCTCTGCAAGAGACTTCCATCCAGTTGCCTTCTTGGGACTGATGCTGGTGACAACCACGG
  CCTTCCCTACTTCACAAGTCCGGAGAGGAGACTTCACAGAGGATACCACTCCCAACAGACCTGTCTATAC
  CACTTCACAAGTCGGAGGCTTAATTACACATGTTCTCTGGGAAATCGTGGAAATGAGAAAAGAGTTGTGC
  AATGGCAATTCTGATTGTATGAACAACGATGATGCACTTGCAGAAAACAATCTGAAACTTCCAGAGATAC
  AAAGAAATGATGGATGCTACCAAACTGGATATAATCAGGAAATTTGCCTATTGAAAATTTCCTCTGGTCT
  TCTGGAGTACCATAGCTACCTGGAGTACATGAAGAACAACTTAAAAGATAACAAGAAAGACAAAGCCAGA
  GTCCTTCAGAGAGATACAGAAACTCTAATTCATATCTTCAACCAAGAGGTAAAAGATTTACATAAAATAG
  TCCTTCCTACCCCAATTTCCAATGCTCTCCTAACAGATAAGCTGGAGTCACAGAAGGAGTGGCTAAGGAC
  CAAGACCATCCAATTCATCTTGAAATCACTTGAAGAATTTCTAAAAGTCACTTTGAGATCTACTCGGCAA
  ACCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_031168
• ORF Size: 636 bp
• Insert Size: 636
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC132458, AAI32459
• RefSeq Size: 709
• RefSeq ORF: 636
• Locus ID: 16193
• Gene Summary: This gene encodes a member of the interleukin family of cytokines that have important functions in immune response, hematopoiesis, inflammation and the acute phase response. The ectopic overexpression of the encoded protein in mice results in excessive plasma cells in circulation, leading to death. Mice lacking the encoded protein exhibit abnormalities in hepatic acute phase response, some immune mechanisms, bone resorption in response to estrogen, liver regeneration and wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).