Fabp6 (NM_008375) Mouse Untagged Clone

CAT#: MC208789

Fabp6 (untagged) - Mouse fatty acid binding protein 6, ileal (gastrotropin) (Fabp6), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fabp6
• Synonyms: GT; I-15P; I-BABP; ILBP; ILBP3; Illbp
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208789 representing NM_008375
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCTTCAGTGGCAAATATGAATTTGAGAGTGAGAAGAATTACGATGAGTTCATGAAGCGCCTGGGTC
  TTCCAGGAGACGTGATTGAAAGGGGACGTAACTTCAAGATCATCACAGAGGTCCAGCAGGACGGACAGGA
  CTTCACCTGGTCCCAGTCTTACTCTGGGGGCAACATTATGAGCAACAAGTTCACCATTGGCAAAGAATGT
  GAAATGCAGACCATGGGGGGCAAGAAGTTCAAGGCTACCGTGAAGATGGAGGGTGGCAAGGTGGTGGCAG
  AGTTCCCCAACTATCACCAGACTTCGGAGGTCGTGGGTGACAAGTTGGTGGAGATCTCCACCATCGGGGA
  TGTGACCTATGAGCGCGTAAGCAAGAGGCTGGCTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_008375
• ORF Size: 387 bp
• Insert Size: 387
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_008375.2, NP_032401.1
• RefSeq Size: 510
• RefSeq ORF: 387
• Locus ID: 16204
• Gene Summary: The protein encoded by this gene is part of the fatty acid binding protein family (FABP). FABPs are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands and participate in fatty acid uptake, transport, and metabolism. This protein functions within the ileum, the distal 25-30% of the small intestine, and plays a role in enterohepatic circulation of bile acids and cholesterol homeostasis. In humans, it has been reported that polymorphisms in FABP6 confer a protective effect in obese individuals from developing type 2 diabetes. In mice deficiency of this gene affects bile acid metabolism in a gender-specific manner and was reported to be required for efficient apical to basolateral transport of conjugated bile acids. [provided by RefSeq, Jan 2013]