Lif (NM_001039537) Mouse Untagged Clone

CAT#: MC208888

Lif (untagged) - Mouse leukemia inhibitory factor (Lif), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Lif
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208888 representing NM_001039537
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAACCAGATCAAGAATCAACTGGCACAGCTCAATGGCAGCGCCAATGCTCTCTTCATTTCCTATTACA
  CAGCTCAAGGGGAGCCGTTTCCCAACAACGTGGAAAAGCTATGTGCGCCTAACATGACAGACTTCCCATC
  TTTCCATGGCAACGGGACAGAGAAGACCAAGTTGGTGGAGCTGTATCGGATGGTCGCATACCTGAGCGCC
  TCCCTGACCAATATCACCCGGGACCAGAAGGTCCTGAACCCCACTGCCGTGAGCCTCCAGGTCAAGCTCA
  ATGCTACTATAGACGTCATGAGGGGCCTCCTCAGCAATGTGCTTTGCCGTCTGTGCAACAAGTACCGTGT
  GGGCCACGTGGATGTGCCACCTGTCCCCGACCACTCTGACAAAGAAGCCTTCCAAAGGAAAAAGTTGGGT
  TGCCAGCTTCTGGGGACATACAAGCAAGTCATAAGTGTGGTGGTCCAGGCCTTCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001039537
• ORF Size: 477 bp
• Insert Size: 477
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001039537.2, NP_001034626.1
• RefSeq Size: 4114
• RefSeq ORF: 477
• Locus ID: 16878
• Gene Summary: LIF has the capacity to induce terminal differentiation in leukemic cells. Its activities include the induction of hematopoietic differentiation in normal and myeloid leukemia cells, the induction of neuronal cell differentiation, and the stimulation of acute-phase protein synthesis in hepatocytes. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.