Mbd3 (NM_013595) Mouse Untagged Clone

CAT#: MC208942

Mbd3 (untagged) - Mouse methyl-CpG binding domain protein 3 (Mbd3), (10ug)


  "NM_013595" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Mbd3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mbd3
Synonyms AI181826; AU019209
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208942 representing NM_013595
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCGGAAGAGGTGGGAGTGCCCGGCGCTCCCGCAGGGCTGGGAAAGGGAAGAAGTGCCCAGGAGGT
CGGGGCTGTCGGCCGGCCACAGGGATGTCTTTTACTATAGCCCCAGCGGGAAGAAGTTCCGCAGCAAGCC
ACAACTGGCACGTTACCTGGGCGGATCCATGGACCTCAGCACCTTCGACTTCCGCACCGGAAAGATGTTG
ATGAACAAGATGAATAAGAGTCGCCAGCGTGTGCGCTATGATTCTTCCAACCAGGTCAAGGGCAAGCCTG
ACCTGAACACCGCGCTGCCTGTACGGCAGACTGCATCCATCTTCAAGCAACCGGTGACCAAGATCACCAA
CCACCCCAGCAACAAGGTCAAGAGCGACCCGCAGAAGGCAGTGGACCAGCCGAGGCAGCTTTTCTGGGAG
AAGAAGCTAAGTGGATTGAGTGCCTTTGACATTGCAGAAGAACTGGTCAGGACCATGGACTTGCCCAAGG
GCCTGCAGGGAGTGGGCCCTGGCTGTACAGATGAGACGCTGCTGTCAGCCATTGCGAGTGCTCTACACAC
CAGCACCCTGCCCATTACAGGCCAGCTCTCTGCAGCCGTGGAGAAGAACCCTGGTGTGTGGCTGAACACT
GCACAGCCACTGTGCAAAGCCTTCATGGTGACAGATGACGACATCAGGAAGCAGGAGGAGCTGGTACAGC
AGGTACGGAAGCGCCTGGAGGAGGCACTGATGGCCGACATGCTAGCTCATGTGGAGGAGCTTGCCCGAGA
CGGGGAGGCACCACTGGACAAGGCCTGTGCAGAGGAGGAAGAGGAGGAGGAAGAGGAGGAGGAAGAGCCG
GAGCCAGAGCGAGTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013595
ORF Size 858 bp
Insert Size 858
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_013595.2, NP_038623.1
RefSeq Size 1589
RefSeq ORF 858
Locus ID 17192
Gene Summary This gene encodes a member of the MBD family of nuclear proteins that contain a methyl-CpG binding domain (MBD). The encoded protein is a component of the nucleosome remodeling and histone deacetylation (NuRD) complex. Deletion of this gene causes embryonic lethality in mice. Embryonic stem cells lacking the encoded protein are severely compromised in their ability to differentiate and fail to commit to developmental lineages in the absence of leukemia inhibitory factor. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.