Mpz (NM_008623) Mouse Untagged Clone

CAT#: MC208973

Mpz (untagged) - Mouse myelin protein zero (Mpz), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Mpz
• Synonyms: Mpp; P-zero; P0
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208973 representing NM_008623
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTCCCGGGGCTCCCTCCTCCAGCCCCAGCCCTATCCTGGCTGCCCTGCTCTTCTCTTCTTTGGTGC
  TCTCTCCAGCCCTGGCCATTGTGGTTTACACGGACAGGGAAATCTATGGTGCCGTGGGCTCCCAGGTGAC
  CCTGCACTGCTCCTTCTGGTCCAGTGAATGGGTCTCAGATGACATCTCTTTTACCTGGCGCTACCAGCCT
  GAAGGGGGCCGAGATGCCATTTCGATCTTCCACTATGCCAAGGGACAACCTTACATCGATGAGGTGGGGA
  CCTTCAAAGAGCGCATCCAGTGGGTAGGGGACCCTCGCTGGAAGGATGGCTCCATTGTCATACACAACCT
  AGACTACAGTGACAACGGCACTTTCACATGTGATGTCAAAAACCCACCGGACATAGTGGGCAAGACCTCT
  CAGGTCACGCTCTATGTCTTTGAAAAAGTGCCCACTAGGTATGGGGTGGTGTTGGGAGCAGTGATCGGGG
  GCATCCTCGGGGTGGTGCTGTTGCTGCTGTTGCTCTTCTACCTGATTCGGTACTGCTGGCTGCGCAGGCA
  GGCTGCCCTGCAGAGAAGGCTCAGTGCCATGGAGAAGGGGAGATTTCACAAATCTTCGAAGGACTCCTCG
  AAGCGAGGGCGGCAGACGCCAGTGCTGTATGCCATGCTGGACCACAGCCGAAGCACCAAAGCTGCCAGTG
  AGAAGAAATCAAAAGGGCTGGGGGAGTCTCGCAAGGATAAGAAATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_008623
• ORF Size: 747 bp
• Insert Size: 747
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_008623.5, NP_032649.2
• RefSeq Size: 2018
• RefSeq ORF: 747
• Locus ID: 17528
• Gene Summary: This gene is specifically expressed in Schwann cells of the peripheral nervous system and encodes a type I transmembrane glycoprotein that is a major structural protein of the peripheral myelin sheath. The encoded protein contains a large hydrophobic extracellular domain and a smaller basic intracellular domain, which are essential for the formation and stabilization of the multilamellar structure of the compact myelin. Mutations in the orthologous gene in human are associated with myelinating neuropathies. A recent study showed that two isoforms are produced from the same mRNA by use of alternative in-frame translation termination codons via a stop codon readthrough mechanism. Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Oct 2015]
  Transcript Variant: This variant (2) has additional 5' non-coding exons compared to variant 1. Variants 1 and 2 encode the same isoform (MPZ). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.