Myl1 (NM_001113387) Mouse Untagged Clone

CAT#: MC209005

Myl1 (untagged) - Mouse myosin, light polypeptide 1 (Myl1), transcript variant 3f, (10ug)


  "NM_001113387" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Myl1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Myl1
Synonyms AI325107; MLC1f; MLC3f; Mylf
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209005 representing NM_001113387
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCTTCAGTGCTGACCAGATTGCCGACTTCAAGGAGGCATTTCTCCTGTTTGACAGAACAGGTGAAT
GCAAGATCACCTTAAGTCAGGTGGGAGACGTCCTCCGGGCTCTGGGCACCAATCCCACCAATGCAGAGGT
CAAGAAGGTTCTTGGGAACCCCAGCAATGAAGAGATGAATGCTAAGAAAATCGAGTTTGAACAGTTTCTG
CCCATGATGCAAGCTATCTCCAACAACAAGGACCAGGGAGGTTATGAAGATTTCGTTGAGGGTCTGCGTG
TCTTCGACAAGGAGGGCAATGGCACCGTCATGGGTGCTGAACTCCGCCATGTCCTCGCCACTCTGGGAGA
GAAGATGAAGGAGGAAGAGGTAGAAGCGTTGCTGGCAGGCCAGGAGGACTCCAATGGCTGCATCAACTAT
GAAGCTTTTGTCAAACACATCATGTCTGTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001113387
ORF Size 453 bp
Insert Size 453
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001113387.1, NP_001106858.1
RefSeq Size 826
RefSeq ORF 453
Locus ID 17901
Gene Summary Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two non-phosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in fast skeletal muscle. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3f) encodes a protein that is 38 aa shorter than isoform 1f. Transcript variants 3f and 1f differ in their first two exons.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.