Nppb (NM_008726) Mouse Untagged Clone

CAT#: MC209050

Nppb (untagged) - Mouse natriuretic peptide type B (Nppb), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Nppb
• Synonyms: AA408272; BNF; BNP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209050 representing NM_008726
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGATCTCCTGAAGGTGCTGTCCCAGATGATTCTGTTTCTGCTTTTCCTTTATCTGTCACCGCTGGGAG
  GTCACTCCTATCCTCTGGGAAGTCCTAGCCAGTCTCCAGAGCAATTCAAGATGCAGAAGCTGCTGGAGCT
  GATAAGAGAAAAGTCGGAGGAAATGGCCCAGAGACAGCTCTTGAAGGACCAAGGCCTCACAAAAGAACAC
  CCAAAAAGAGTCCTTCGGTCTCAAGGCAGCACCCTCCGGGTCCAGCAGAGACCTCAAAATTCCAAGGTGA
  CACATATCTCAAGCTGCTTTGGGCACAAGATAGACCGGATCGGATCCGTCAGTCGTTTGGGCTGTAACGC
  ACTGAAGTTGTTGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_008726
• ORF Size: 366 bp
• Insert Size: 366
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_008726.5, NP_032752.1
• RefSeq Size: 781
• RefSeq ORF: 366
• Locus ID: 18158
• Gene Summary: This gene encodes a secreted protein that belongs to the family of natriuretic peptides. Its precursor protein is processed to generate the active mature peptide. The mature peptide is a cardiac hormone that plays a role in ventricular remodeling as well as blood pressure regulation. Mice lacking this gene exhibit cardiac fibrosis. In humans this gene is associated with congestive heart failure, low bone-mineral density and postmenopausal osteoporosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2013]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1, also known as Long isoform).