Oxt (NM_011025) Mouse Untagged Clone

CAT#: MC209130

Oxt (untagged) - Mouse oxytocin (Oxt), (10ug)


  "NM_011025" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Oxt
Synonyms OT; Oxy
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209130 representing NM_011025
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCTGCCCCAGTCTCGCTTGCTGCCTGCTTGGCTTACTGGCTCTGACCTCGGCCTGCTACATCCAGA
ACTGCCCCCTGGGCGGCAAGAGGGCTGTGCTGGACCTGGATATGCGCAAGTGTCTCCCCTGCGGCCCGGG
CGGCAAAGGACGCTGCTTCGGACCAAGCATCTGCTGCGCGGACGAGCTGGGCTGCTTCGTGGGCACCGCC
GAGGCGCTGCGCTGCCAGGAGGAGAACTACCTGCCTTCGCCCTGCCAGTCTGGCCAGAAGCCCTGCGGGA
GCGGAGGCCGCTGCGCCGCCACAGGCATCTGCTGCAGCCCGGATGGCTGCCGCACAGACCCCGCCTGCGA
CCCTGAGTCTGCCTTCTCGGAGCGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011025
ORF Size 378 bp
Insert Size 378
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_011025.4, NP_035155.1
RefSeq Size 555
RefSeq ORF 378
Locus ID 18429
Gene Summary This gene encodes a preproprotein that is processed to produce oxytocin and neurophysin 1. Oxytocin is a posterior pituitary hormone which is synthesized as an inactive precursor in the hypothalamus along with its carrier protein neurophysin 1. Together with neurophysin, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis, where it is either stored or secreted into the bloodstream. The precursor seems to be activated while it is being transported along the axon to the posterior pituitary. This hormone contracts smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation, the stress response and complex sexual and maternal behavior, as well as in the regulation of water excretion, salt appetite, blood pressure and cardiovascular functions. Deletion of this gene in mouse reduces bone formation resulting in osteoporosis. [provided by RefSeq, Dec 2013]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.