Oxt (NM_011025) Mouse Untagged Clone

CAT#: MC209130

Oxt (untagged) - Mouse oxytocin (Oxt), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Oxt
• Synonyms: OT; Oxy
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209130 representing NM_011025
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCTGCCCCAGTCTCGCTTGCTGCCTGCTTGGCTTACTGGCTCTGACCTCGGCCTGCTACATCCAGA
  ACTGCCCCCTGGGCGGCAAGAGGGCTGTGCTGGACCTGGATATGCGCAAGTGTCTCCCCTGCGGCCCGGG
  CGGCAAAGGACGCTGCTTCGGACCAAGCATCTGCTGCGCGGACGAGCTGGGCTGCTTCGTGGGCACCGCC
  GAGGCGCTGCGCTGCCAGGAGGAGAACTACCTGCCTTCGCCCTGCCAGTCTGGCCAGAAGCCCTGCGGGA
  GCGGAGGCCGCTGCGCCGCCACAGGCATCTGCTGCAGCCCGGATGGCTGCCGCACAGACCCCGCCTGCGA
  CCCTGAGTCTGCCTTCTCGGAGCGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_011025
• ORF Size: 378 bp
• Insert Size: 378
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_011025.4, NP_035155.1
• RefSeq Size: 555
• RefSeq ORF: 378
• Locus ID: 18429
• Gene Summary: This gene encodes a preproprotein that is processed to produce oxytocin and neurophysin 1. Oxytocin is a posterior pituitary hormone which is synthesized as an inactive precursor in the hypothalamus along with its carrier protein neurophysin 1. Together with neurophysin, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis, where it is either stored or secreted into the bloodstream. The precursor seems to be activated while it is being transported along the axon to the posterior pituitary. This hormone contracts smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation, the stress response and complex sexual and maternal behavior, as well as in the regulation of water excretion, salt appetite, blood pressure and cardiovascular functions. Deletion of this gene in mouse reduces bone formation resulting in osteoporosis. [provided by RefSeq, Dec 2013]