Pcp2 (NM_001129804) Mouse Untagged Clone

CAT#: MC209150

Pcp2 (untagged) - Mouse Purkinje cell protein 2 (L7) (Pcp2), transcript variant 2, (10ug)


  "NM_001129804" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pcp2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pcp2
Synonyms L7; Pcp-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209150 representing NM_001129804
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGGTTCACCGGACCAGGAAGGCTTCTTCAACCTGCTGACCCACGTGCAGGGCGATCGGATGGAGG
AGCAGCGCTGTTCCTTGCAGGCTGGGCCAGGCCAGAACCCAGAAAGCCAGGGTGGCCCTGCTCCAGAGAT
GGACAATCTCATGGATATGCTGGTCAACACCCAGGGCCGCCGCATGGACGACCAGCGTGTAACAGTTAAT
TCCCTGCCTGGCTTCCAACCTATCGGCCCCAAGGATGGAATGCAGAAACGACCTGGGACCCTCAGCCCTC
AACCCCTGCTCACCCCTCAGGATCCTGCTGCACTCAGCTTCCGCAGGAACAGCAGCCCCCAGCCCCAGAC
ACAAGCTCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001129804
ORF Size 363 bp
Insert Size 363
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001129804.1, NP_001123276.1
RefSeq Size 473
RefSeq ORF 363
Locus ID 18545
Gene Summary May function as a cell-type specific modulator for G protein-mediated cell signaling. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) includes an alternate exon in the 5' UTR and 5' CDS, compared to variant 1. It encodes isoform 2 which is shorter and has a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.