Pcp4 (NM_008791) Mouse Untagged Clone

CAT#: MC209153

Pcp4 (untagged) - Mouse Purkinje cell protein 4 (Pcp4), (10ug)


  "NM_008791" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pcp4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pcp4
Synonyms P16Rimb19; Pcp-4; Pep19
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209153 representing NM_008791
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGAGAGACAAAGTGCCGGAGCGACCAACGGAAAAGACAAGACGTCAGGAGATAATGATGGGCAGA
AGAAAGTCCAAGAAGAATTTGATATCGACATGGATGCACCAGAGACAGAGCGTGCAGCTGTGGCCATTCA
GTCTCAGTTCAGAAAATTCCAGAAGAAAAAGGCAGGATCACAGTCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008791
ORF Size 189 bp
Insert Size 189
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_008791.2, NP_032817.1
RefSeq Size 669
RefSeq ORF 189
Locus ID 18546

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.