Pln (NM_001141927) Mouse Untagged Clone

CAT#: MC209191

Pln (untagged) - Mouse phospholamban (Pln), transcript variant 1, (10ug)


  "NM_001141927" in other vectors (3)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pln
Synonyms Plb
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209191 representing NM_001141927
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAAAAGTGCAATACCTCACTCGCTCGGCTATCAGGAGAGCCTCCACTATTGAAATGCCTCAGCAAG
CACGTCAGAATCTCCAGAACCTATTTATCAATTTCTGCCTCATCTTGATATGTCTGCTGCTGATCTGCAT
CATTGTGATGCTTCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001141927
ORF Size 159 bp
Insert Size 159
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001141927.1, NP_001135399.1
RefSeq Size 2480
RefSeq ORF 159
Locus ID 18821

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.