Ccl21a (NM_011124) Mouse Untagged Clone

CAT#: MC209193

Ccl21a (untagged) - Mouse chemokine (C-C motif) ligand 21A (serine) (Ccl21a), (10ug)


  "NM_011124" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Ccl21a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ccl21a
Synonyms 6CKBAC2; 6Ckine; ALP; AW987545; CKb9; plt; Scya21; SCYA21a; Scya21b; SLC; Tca4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209193 representing NM_011124
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTCAGATGATGACTCTGAGCCTCCTTAGCCTGGTCCTGGCTCTCTGCATCCCCTGGACCCAAGGCA
GTGATGGAGGGGGTCAGGACTGCTGCCTTAAGTACAGCCAGAAGAAAATTCCCTACAGTATTGTCCGAGG
CTATAGGAAGCAAGAACCAAGTTTAGGCTGTCCCATCCCGGCAATCCTGTTCTCACCCCGGAAGCACTCT
AAGCCTGAGCTATGTGCAAACCCTGAGGAAGGCTGGGTGCAGAACCTGATGCGCCGCCTGGACCAGCCTC
CAGCCCCAGGGAAACAAAGCCCCGGCTGCAGGAAGAACCGGGGAACCTCTAAGTCTGGAAAGAAAGGAAA
GGGCTCCAAGGGCTGCAAGAGAACTGAACAGACACAGCCCTCAAGAGGATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_011124
ORF Size 402 bp
Insert Size 402
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq BC087957, AAH87957
RefSeq Size 868
RefSeq ORF 402
Locus ID 18829
Gene Summary Inhibits hemopoiesis and stimulates chemotaxis. Chemotactic in vitro for thymocytes and activated T-cells, but not for B-cells, macrophages, or neutrophils. Potent mesangial cell chemoattractant. Shows preferential activity towards naive T-cells. May play a role in mediating homing of lymphocytes to secondary lymphoid organs. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.