Ppp3r1 (NM_024459) Mouse Untagged Clone

CAT#: MC209218

Ppp3r1 (untagged) - Mouse protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type I) (Ppp3r1), (10ug)


  "NM_024459" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ppp3r1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ppp3r1
Synonyms CaNB1; Cnb1; MCIP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209218 representing NM_024459
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGAAATGAGGCGAGTTACCCTTTGGAAATGTGCTCACACTTTGATGCTGATGAAATTAAAAGGCTAG
GAAAGAGATTCAAGAAGCTTGATTTGGACAATTCTGGTTCTTTGAGCGTGGAAGAGTTCATGTCTCTGCC
TGAGTTACAGCAGAACCCTTTAGTACAGCGGGTAATAGATATATTCGACACAGACGGCAACGGAGAAGTG
GACTTCAAAGAATTCATTGAAGGAGTGTCTCAGTTCAGTGTCAAAGGCGATAAGGAACAGAAGTTGAGGT
TTGCTTTTCGTATCTATGACATGGATAAAGATGGCTATATTTCCAATGGAGAACTCTTCCAGGTGTTGAA
GATGATGGTGGGCAACAATCTGAAAGATACACAATTACAGCAGATTGTAGACAAAACCATAATAAATGCA
GATAAGGATGGAGATGGAAGAATATCCTTTGAGGAATTCTGTGCTGTCGTAGGTGGCCTAGATATCCACA
AAAAGATGGTGGTGGATGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_024459
ORF Size 513 bp
Insert Size 513
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_024459.2, NP_077779.2
RefSeq Size 2829
RefSeq ORF 513
Locus ID 19058
Gene Summary Regulatory subunit of calcineurin, a calcium-dependent, calmodulin stimulated protein phosphatase. Confers calcium sensitivity. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.