Rps29 (NM_009093) Mouse Untagged Clone

CAT#: MC209335

Rps29 (untagged) - Mouse ribosomal protein S29 (Rps29), (10ug)


  "NM_009093" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rps29"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rps29
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209335 representing NM_009093
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGTCACCAGCAGCTCTACTGGAGTCACCCACGGAAGTTCGGCCAGGGTTCCCGCTCTTGCCGCGTCT
GCTCCAACCGCCACGGTCTGATCCGCAAATACGGGCTGAACATGTGCCGCCAGTGCTTCCGGCAGTACGC
GAAGGACATAGGCTTCATTAAGTTGGACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009093
ORF Size 171 bp
Insert Size 171
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_009093.2, NP_033119.1
RefSeq Size 449
RefSeq ORF 171
Locus ID 20090

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.