S100a10 (NM_009112) Mouse Untagged Clone

CAT#: MC209344

S100a10 (untagged) - Mouse S100 calcium binding protein A10 (calpactin) (S100a10), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: S100a10
• Synonyms: 42C; AA409961; AL024248; Cal1l; CAL12; CLP11; p10; p11
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209344 representing NM_009112
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCATCCCAAATGGAGCACGCCATGGAAACCATGATGCTTACGTTTCACAGGTTTGCAGGCGACAAAG
  ACCACTTGACAAAGGAGGACCTGAGAGTGCTCATGGAACGGGAGTTCCCTGGGTTTTTGGAAAATCAAAA
  GGACCCTCTGGCTGTGGACAAAATAATGAAGGACCTGGACCAGTGCCGAGATGGCAAAGTGGGCTTCCAG
  AGCTTTCTATCACTAGTGGCAGGGCTCACCATTGCATGCAATGACTATTTTGTAGTAAACATGAAGCAGA
  AGGGGAAGAAGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009112
• ORF Size: 294 bp
• Insert Size: 294
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_009112.2, NP_033138.1
• RefSeq Size: 650
• RefSeq ORF: 294
• Locus ID: 20194
• Gene Summary: Because S100A10 induces the dimerization of ANXA2/p36, it may function as a regulator of protein phosphorylation in that the ANXA2 monomer is the preferred target (in vitro) of tyrosine-specific kinase. [UniProtKB/Swiss-Prot Function]