Ccl9 (NM_011338) Mouse Untagged Clone

CAT#: MC209368

Ccl9 (untagged) - Mouse chemokine (C-C motif) ligand 9 (Ccl9), (10ug)


  "NM_011338" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ccl9"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ccl9
Synonyms CCF18; MRP-2; Scya9; Scya10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209368 representing NM_011338
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGCCTTTTCATACTGCCCTCTCCTTCCTCATTCTTACAACTGCTCTTGGAATCTGGGCCCAGATCA
CACATGCAACAGAGACAAAAGAAGTCCAGAGCAGTCTGAAGGCACAGCAAGGGCTTGAAATTGAAATGTT
TCACATGGGCTTTCAAGACTCTTCAGATTGCTGCCTGTCCTATAACTCACGGATTCAGTGTTCAAGATTT
ATAGGTTATTTTCCCACCAGTGGTGGGTGTACCAGGCCGGGCATCATCTTTATCAGCAAGAGGGGGTTCC
AGGTCTGTGCCAACCCCAGTGATCGGAGAGTTCAGAGATGCATTGAAAGATTGGAGCAAAACTCACAACC
ACGGACCTACAAACAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011338
ORF Size 369 bp
Insert Size 369
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_011338.2, NP_035468.1
RefSeq Size 3008
RefSeq ORF 369
Locus ID 20308
Gene Summary Monokine with inflammatory, pyrogenic and chemokinetic properties. Circulates at high concentrations in the blood of healthy animals. Binding to a high-affinity receptor activates calcium release in neutrophils. It also inhibits colony formation of bone marrow myeloid immature progenitors. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.