Cxcl2 (NM_009140) Mouse Untagged Clone

CAT#: MC209369

Cxcl2 (untagged) - Mouse chemokine (C-X-C motif) ligand 2 (Cxcl2), (10ug)


  "NM_009140" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cxcl2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cxcl2
Synonyms CINC-2a; Gro2; GROb; Mgsa-b; MIP-2; MIP-2a; Mip2; Scyb; Scyb2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209369 representing NM_009140
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCCTCCCACCTGCCGGCTCCTCAGTGCTGCACTGGTCCTGCTGCTGCTGCTGGCCACCAACCACC
AGGCTACAGGGGCTGTTGTGGCCAGTGAACTGCGCTGTCAATGCCTGAAGACCCTGCCAAGGGTTGACTT
CAAGAACATCCAGAGCTTGAGTGTGACGCCCCCAGGACCCCACTGCGCCCAGACAGAAGTCATAGCCACT
CTCAAGGGCGGTCAAAAAGTTTGCCTTGACCCTGAAGCCCCCCTGGTTCAGAAAATCATCCAAAAGATAC
TGAACAAAGGCAAGGCTAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009140
ORF Size 303 bp
Insert Size 303
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_009140.2, NP_033166.1
RefSeq Size 1083
RefSeq ORF 303
Locus ID 20310
Gene Summary Chemotactic for human polymorphonuclear leukocytes but does not induce chemokinesis or an oxidative burst. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.