Cxcl12 (NM_001012477) Mouse Untagged Clone

CAT#: MC209371

Cxcl12 (untagged) - Mouse chemokine (C-X-C motif) ligand 12 (Cxcl12), transcript variant 3, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cxcl12
• Synonyms: Pbsf; Scyb12; Sdf1; Tlsf; Tpar1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209371 representing NM_001012477
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACGCCAAGGTCGTCGCCGTGCTGGCCCTGGTGCTGGCCGCGCTCTGCATCAGTGACGGTAAACCAG
  TCAGCCTGAGCTACCGATGCCCCTGCCGGTTCTTCGAGAGCCACATCGCCAGAGCCAACGTCAAGCATCT
  GAAAATCCTCAACACTCCAAACTGTGCCCTTCAGATTGTTGCACGGCTGAAGAACAACAACAGACAAGTG
  TGCATTGACCCGAAATTAAAGTGGATCCAAGAGTACCTGGAGAAAGCTTTAAACAAGGGGCGCAGAGAAG
  AAAAAGTGGGGAAAAAAGAAAAGATAGGAAAAAAGAAGCGACAGAAGAAGAGAAAGGCTGCCCAGAAAAG
  GAAAAACTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001012477
• Insert Size: 360 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001012477.2, NP_001012495.1
• RefSeq Size: 5670 bp
• RefSeq ORF: 360 bp
• Locus ID: 20315
• Cytogenetics: 6 F1
• Gene Summary: This gene encodes a member of the alpha chemokine protein family. The encoded protein is secreted and functions as the ligand for the G-protein coupled receptor, chemokine (C-X-C motif) receptor 4. The encoded protein plays a role in many diverse cellular functions, including embryogenesis, immune surveillance, inflammation response, tissue homeostasis, and tumor growth and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
  Transcript Variant: This variant (3) represents the longest transcript and encodes the longest isoform (gamma). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.