Cxcl12 (NM_013655) Mouse Untagged Clone

CAT#: MC209372

Cxcl12 (untagged) - Mouse chemokine (C-X-C motif) ligand 12 (Cxcl12), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cxcl12
• Synonyms: Pbsf; Scyb12; Sdf1; Tlsf; Tpar1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209372 representing NM_013655
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACGCCAAGGTCGTCGCCGTGCTGGCCCTGGTGCTGGCCGCGCTCTGCATCAGTGACGGTAAACCAG
  TCAGCCTGAGCTACCGATGCCCCTGCCGGTTCTTCGAGAGCCACATCGCCAGAGCCAACGTCAAGCATCT
  GAAAATCCTCAACACTCCAAACTGTGCCCTTCAGATTGTTGCACGGCTGAAGAACAACAACAGACAAGTG
  TGCATTGACCCGAAATTAAAGTGGATCCAAGAGTACCTGGAGAAAGCTTTAAACAAGAGGCTCAAGATGT
  GA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_013655
• ORF Size: 282 bp
• Insert Size: 282
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_013655.4, NP_038683.1
• RefSeq Size: 3173
• RefSeq ORF: 282
• Locus ID: 20315
• Gene Summary: This gene encodes a member of the alpha chemokine protein family. The encoded protein is secreted and functions as the ligand for the G-protein coupled receptor, chemokine (C-X-C motif) receptor 4. The encoded protein plays a role in many diverse cellular functions, including embryogenesis, immune surveillance, inflammation response, tissue homeostasis, and tumor growth and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region compared to variant 3. The resulting isoform (beta) is shorter and has a distinct C-terminus compared to isoform gamma. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.