Dynlt1b (NM_009342) Mouse Untagged Clone

CAT#: MC209505

Dynlt1b (untagged) - Mouse dynein light chain Tctex-type 1D (Dynlt1b), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dynlt1b
• Synonyms: AGS2; Dynlt1; Tctex-1; Tctex1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209505 representing NM_009342
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAAGACTTCCAGGCCTCAGAGGAGACTGCATTTGTTGTTGATGAAGTGAGCAGCATTGTAAAGGAGG
  CTATAGAAAGCGCCATCGGTGGTAATGCCTACCAGCACAGCAAAGTCAACCAGTGGACCACTAATGTCCT
  AGAACAGACTTTGAGCCAACTCACCAAACTGGGGAGACCATTTAAATACATTGTGACCTGTGTGATCATG
  CAGAAGAACGGTGCTGGGTTACACTCCGCAAGTTCCTGCTTCTGGGACAGCTCCACAGACGGAAGCTGCA
  CAGTCCGATGGGAGAACAAGACCATGTACTGCATCGTCAGTACCTTCGGACTGTCCATCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009342
• ORF Size: 342 bp
• Insert Size: 342
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_009342.2, NP_033368.1
• RefSeq Size: 791
• RefSeq ORF: 342
• Locus ID: 21648
• Gene Summary: Plays a role in neuronal morphogenesis; the function is independent of cytoplasmic dynein and seems to be coupled to regulation of the actin cytoskeleton by enhancing Rac1 activity. The function in neurogenesis may be regulated by association with a G-protein beta-gamma dimer. May function as a receptor-independent activator of heterotrimeric G-protein signaling; the activation appears to be independent of a nucleotide exchange. Plays a role in regulating neurogenesis; inhibits the genesis of neurons from precursor cells during cortical development presumably by antagonizing ARHGEF2. Involved in the regulation of mitotic spindle orientation. [UniProtKB/Swiss-Prot Function]