Tnfsf4 (NM_009452) Mouse Untagged Clone
CAT#: MC209603
Tnfsf4 (untagged) - Mouse tumor necrosis factor (ligand) superfamily, member 4 (Tnfsf4), (10ug)
"NM_009452" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Tnfsf4 |
Synonyms | Ath-1; Ath1; CD134L; gp34; OX-40L; Ox40l; Tnlg2b; TXGP1; Txgp1l |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209603 representing NM_009452
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_009452 |
ORF Size | 597 bp |
Insert Size | 597 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_009452.2, NP_033478.1 |
RefSeq Size | 1609 |
RefSeq ORF | 597 |
Locus ID | 22164 |
Gene Summary | Cytokine that binds to TNFRSF4. Co-stimulates T-cell proliferation and cytokine production. [UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR223452 | Tnfsf4 (Myc-DDK-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 4 (Tnfsf4) |
USD 68.00 |
|
MG223452 | Tnfsf4 (GFP-tagged) - Mouse tumor necrosis factor (ligand) superfamily member 4 (Tnfsf4), (10ug) |
USD 300.00 |
|
MR223452L1 | Lenti ORF clone of Tnfsf4 (Myc-DDK-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 4 (Tnfsf4) |
USD 624.00 |
|
MR223452L2 | Lenti ORF clone of Tnfsf4 (mGFP-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 4 (Tnfsf4) |
USD 500.00 |
|
MR223452L3 | Lenti ORF clone of Tnfsf4 (Myc-DDK-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 4 (Tnfsf4) |
USD 500.00 |
|
MR223452L4 | Lenti ORF clone of Tnfsf4 (mGFP-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 4 (Tnfsf4) |
USD 624.00 |
{0} Product Review(s)
Be the first one to submit a review