Ucn (NM_021290) Mouse Untagged Clone

CAT#: MC209615

Ucn (untagged) - Mouse urocortin (Ucn), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ucn
• Synonyms: Mpv17; Ucn1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209615 representing NM_021290
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATACAGAGGGGACGCGCTACGCTCCTGGTGGCGTTGCTGCTCTTGGCACAGCTTCGCCCGGAGAGCA
  GCCAGTGGAGCCCAGCGGCTGCGGCGGCAACTGGGGTCCAGGATCCGAATCTGCGATGGAGCCCTGGAGT
  GCGGAATCAGGGCGGCGGCGTCCGCGCGCTCCTCTTGCTGTTAGCGGAGCGCTTCCCGCGCCGCGCAGGA
  TCTGAGCCTGCGGGCGAGCGGCAGCGACGGGACGACCCTCCACTGTCCATCGACCTCACCTTCCACCTGC
  TGCGGACCCTGCTGGAGCTAGCTCGGACACAGAGCCAGCGCGAGCGCGCAGAGCAGAACCGCATCATATT
  CGATTCGGTGGGCAAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_021290
• ORF Size: 369 bp
• Insert Size: 369
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_021290.2, NP_067265.1
• RefSeq Size: 644
• RefSeq ORF: 369
• Locus ID: 22226
• Gene Summary: This gene encodes a member of the corticotropin-releasing hormone peptide family that participates in coordinating autonomic, endocrine, and behavioral responses to stress. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional hormone. Mice lacking the encoded protein exhibit a heightened anxiety-like behaviors and a significantly reduced acoustic startle response. [provided by RefSeq, Sep 2016]
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.