Usf1 (NM_009480) Mouse Untagged Clone

CAT#: MC209623

Usf1 (untagged) - Mouse upstream transcription factor 1 (Usf1), (10ug)


  "NM_009480" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Usf1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Usf1
Synonyms bHLHb11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209623 representing NM_009480
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGGGCAGCAGAAAACAGCTGAAACCGAAGAGGGAACAGTGCAGATTCAGGAAGGCGCAGTGGCTA
CTGGAGAGGACCCAACTAGTGTAGCTATCGCCAGCATCCAGTCAGCTGCCACTTTTCCTGACCCCAACGT
CAAGTACGTCTTCCGAACTGAGAATGGGGGCCAGGTGATGTACAGGGTGATCCAGGTGTCAGAGGGGCAG
CTGGATGGCCAGACAGAGGGCTCTGGCGCCATCAGTGGTTACCCTGCCACTCAGTCTATGACCCAGGCAG
TGATCCAGGGAGCTTTCACCAGTGACGATGCCGTTGACACGGAGGGAGCAGCTGCTGAGACACATTATAC
ATATTTCCCCAGCACCGCAGTGGGAGATGGGTCAGGGGGTACCACATCTGGGAGTACTACAGCTGTTGTT
ACCACCCAGGGCTCAGAGGCACTACTGGGGCAGGCAACCCCGCCCAGCACAGGTCAATTCTTTGTGATGA
TGTCACCACAAGAAGTATTGCAGGGAGGGAGCCAGCGATCGATTGCCCCCAGGACCCACCCTTATTCCCC
GAAGTCAGAGGCTCCCAGGACAACTCGAGATGAGAAACGGAGGGCTCAACATAACGAAGTGGAGCGCCGC
CGCCGGGACAAGATCAACAACTGGATTGTACAGCTGTCCAAAATCATCCCAGACTGCTCTATGGAGAGCA
CCAAGTCTGGCCAGAGTAAAGGTGGAATCCTGTCCAAAGCCTGTGATTATATCCAGGAGCTGCGGCAGAG
CAACCACCGGCTGTCTGAAGAGCTGCAGGGGTTAGATCAGTTGCAGCTGGACAACGATGTGCTCCGGCAA
CAGGTGGAAGATCTCAAGAACAAGAACCTGCTCCTGCGAGCTCAGCTTCGGCACCACGGACTCGAGGTCG
TCATCAAGAATGACAGCAACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009480
ORF Size 933 bp
Insert Size 933
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_009480.3, NP_033506.1
RefSeq Size 1853
RefSeq ORF 933
Locus ID 22278
Gene Summary This protein encoded by this gene is a member of the basic-Helix-Hoop-Helix-Leucine zipper (bHLH-LZ) family and encodes a protein that can act as a transcription factor. Studies indicate that the basic region interacts with DNA at E-Box motifs, while the helix-loop-helix and leucine zipper domains are involved in dimerization with different partners. This protein is involved in a wide array of biological pathways, including cell cycle regulation, immune response, and responses to ultraviolet radiation. Mice lacking most of the coding exons of this gene often lacked both whiskers and nasal fur, and were prone to epileptic seizures, while mice lacking both this gene and another family member, Usf2, displayed embryonic lethality (PMID:9520440). Mutations in the human ortholog of this gene have been associated with Familial Combined Hyperlipidemia (FCHL) in humans. Pseudogenes of this gene are found on chromosome 11 and the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. The 5' terminal exon of this transcript was described in PMID:8938446, and is supported by RNASeq data. Variants 1, 2, and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the 5' terminal exon were described in PMID: 8938446.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.