Lin7c (NM_011699) Mouse Untagged Clone

CAT#: MC209639

Lin7c (untagged) - Mouse lin-7 homolog C (C. elegans) (Lin7c), (10ug)


  "NM_011699" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Lin7c"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Lin7c
Synonyms 9130007B12Rik; AI303698; AU019331; AW125731; D2Ertd520e; LIN-7-C; LIN-7C; MALS-3; Veli3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209639 representing NM_011699
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCGCTGGGCGAACCTGTCCGGCTGGAAAGGGATATCTGCAGAGCAATTGAATTGTTGGAGAAAT
TACAGAGGAGTGGAGAGGTGCCGCCACAGAAACTTCAGGCTTTGCAAAGAGTCCTTCAGAGTGAGTTCTG
CAATGCTGTAAGAGAGGTATACGAACATGTTTATGAGACGGTGGACATCAGCAGCAGCCCTGAAGTGAGA
GCCAATGCAACTGCAAAGGCTACTGTTGCTGCATTTGCTGCCAGTGAAGGACACTCTCATCCCCGAGTTG
TTGAGCTACCCAAAACAGAAGAGGGCCTTGGATTCAATATTATGGGAGGCAAAGAGCAAAACTCACCAAT
CTATATATCGCGGATAATTCCAGGTGGAATTGCTGACAGACATGGGGGCCTCAAACGAGGAGATCAGCTA
CTTTCTGTTAATGGAGTGAGTGTTGAAGGGGAGCACCATGAGAAAGCGGTAGAGCTACTGAAAGCAGCCC
AAGGGAAGGTTAAATTAGTCGTACGGTACACACCAAAAGTCTTGGAAGAAATGGAGTCCCGCTTTGAGAA
AATGAGATCAGCAAAACGCAGACAACAGACCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011699
ORF Size 594 bp
Insert Size 594
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_011699.3, NP_035829.1
RefSeq Size 4137
RefSeq ORF 594
Locus ID 22343
Gene Summary Plays a role in establishing and maintaining the asymmetric distribution of channels and receptors at the plasma membrane of polarized cells. Forms membrane-associated multiprotein complexes that may regulate delivery and recycling of proteins to the correct membrane domains. The tripartite complex composed of LIN7 (LIN7A, LIN7B or LIN7C), CASK and APBA1 may have the potential to couple synaptic vesicle exocytosis to cell adhesion in brain. Ensures the proper localization of GRIN2B (subunit 2B of the NMDA receptor) to neuronal postsynaptic density and may function in localizing synaptic vesicles at synapses where it is recruited by beta-catenin and cadherin. Required to localize Kir2 channels, GABA transporter (SLC6A12) and EGFR/ERBB1, ERBB2, ERBB3 and ERBB4 to the basolateral membrane of epithelial cells. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.