Cartpt (NM_013732) Mouse Untagged Clone

CAT#: MC209777

Cartpt (untagged) - Mouse CART prepropeptide (Cartpt), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cartpt
• Synonyms: Cart
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209777 representing NM_013732
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGAGCTCCCGCCTGCGGCTGCTACCCCTCCTGGGCGCCGCCCTGCTGCTACTGCTACCTTTGCTGG
  GTGCCCGTGCCCAGGAGGACGCCGAGCTGCAGCCCCGAGCCCTGGACATCTACTCTGCCGTGGATGATGC
  GTCCCACGAGAAGGAGCTGCCAAGGCGGCAACTTCGGGCTCCCGGCGCTATGTTGCAGATCGAAGCGTTG
  CAAGAAGTCCTGAAGAAGCTCAAGAGTAAACGCATTCCGATCTACGAGAAGAAGTACGGCCAAGTCCCCA
  TGTGTGACGCTGGAGAGCAGTGCGCAGTGAGGAAAGGGGCCAGGATCGGGAAGCTGTGTGACTGTCCCCG
  AGGAACTTCCTGCAATTCTTTCCTCTTGAAGTGCTTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_013732
• ORF Size: 390 bp
• Insert Size: 390
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_013732.7, NP_038760.3
• RefSeq Size: 875
• RefSeq ORF: 390
• Locus ID: 27220
• Gene Summary: This gene encodes preproprotein isoforms that are processed into multiple biologically active peptides. Expression of this gene is regulated by cocaine and other drugs, and is associated with feeding/appetite and stress response. Mice lacking the encoded protein are predisposed to obesity. Deficiency of the encoded protein in mice results in pancreatic islet dysfunction, impaired insulin secretion and glucose intolerance. Alternative splicing results in multiple transcript variants encoding different isoforms, which are subsequently processed into mature peptides. [provided by RefSeq, Jul 2015]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).