Abcc5 (NM_176839) Mouse Untagged Clone

CAT#: MC209798

Abcc5 (untagged) - Mouse ATP-binding cassette, sub-family C (CFTR/MRP), member 5 (Abcc5), transcript variant 2, (10ug)


  "NM_176839" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Abcc5"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Abcc5
Synonyms 2900011L11Rik; Abcc5a; Abcc5b; AI132311; Mrp5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209798 representing NM_176839
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAGATATTGACATGGGAAAAGAATATATCATCCCCAGCCCTGGGTACAGAAGTGACAGGGACAGAA
GCGCTGTACCAGGGCAACACAGAGACCCCGAGGAACCCAGGTTCCGGAGAACAAGATCGTTGGAATGCCA
AGATGCTCTCGAAACAGCAGCCCGAGTTGAGGGGCTTTCCCTGGATATCTCTGTGCATTCTCATCTCCAA
ATTCTGGACGAGGAGCATTCTAAGGGAAAATACCACCATGGTTTAAGTGTCCTGAAGCCCTTCCGGACCA
CTACCAAGCACCAGCACCCAGTGGACAATGCTGGACTTTTCTCCTACATGACCTTTTCATGGCTCTCTCC
TCTGGCCCGAGTGGTTCACAAGAAGGGGGAGCTGTTAATGGAGGATGTGTGGCCTTTGTCCAAGTATGAG
TCTTCTGATGTGAACAGCAGAAGACTAGAGAGACTGTGGCAAGAAGAGCTGAATGAAGTTGGGCCAGACG
CTGCCTCCCTGCGAAGGGTTGTGTGGATCTTTTGCCGCACCAGGCTCATCCTGTCCATCGTGTGCCTGAT
GATCACGCAGTTGGCTGGCTTCAGTGGACCAAATTTTCAGGATGGCTGTATTCTGCGGTCAGAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_176839
ORF Size 627 bp
Insert Size 627
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_176839.1, NP_789809.1
RefSeq Size 1204
RefSeq ORF 627
Locus ID 27416
Gene Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that the human protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks multiple 3' exons but has two alternate 3' exons, as compared to variant 1. The encoded isoform (2) is much shorter and has a distinct C-terminus, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.