Il22 (NM_016971) Mouse Untagged Clone

CAT#: MC209879

Il22 (untagged) - Mouse interleukin 22 (Il22), (10ug)


  "NM_016971" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Il22"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Il22
Synonyms IL-22; IL-22a; Iltif; ILTIFa
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_016971, the custom clone sequence may differ by one or more nucleotides


ATGGCTGTCCTGCAGAAATCTATGAGTTTTTCCCTTATGGGGACTTTGGCCGCCAGCTGCCTGCTTCTCA
TTGCCCTGTGGGCCCAGGAGGCAAATGCGCTGCCCGTCAACACCCGGTGCAAGCTTGAGGTGTCCAACTT
CCAGCAGCCGTACATCGTCAACCGCACCTTTATGCTGGCCAAGGAGGCCAGCCTTGCAGATAACAACACA
GATGTCCGGCTCATCGGGGAGAAACTGTTCCGAGGAGTCAATGCTAAGGATCAGTGCTACCTGATGAAGC
AGGTGCTCAACTTCACCCTGGAAGACGTTCTGCTCCCCCAGTCAGACAGGTTCCAGCCCTACATGCAGGA
GGTGGTGCCTTTCCTGACCAAACTCAGCAATCAGCTCAGCTCCTGTCACATCAGCGGTGACGACCAGAAC
ATCCAGAAGAATGTCAGAAGGCTGAAGGAGACAGTGAAAAAGCTTGGAGAGAGTGGAGAGATCAAGGCGA
TTGGGGAACTGGACCTGCTGTTTATGTCTCTGAGAAATGCTTGCGTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_016971
ORF Size 540 bp
Insert Size 540
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC104348, AAI04349
RefSeq Size 682
RefSeq ORF 540
Locus ID 50929
Gene Summary Cytokine that contributes to the inflammatory response in vivo. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.