Il1f5 (NM_001146087) Mouse Untagged Clone

CAT#: MC209981

Il1f5 (untagged) - Mouse interleukin 1 family, member 5 (delta) (Il1f5), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Il1f5
• Synonyms: AI413231; Fil1delta; Il-1h3; IL-36Ra; Il1hy1; IL36RN
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001146087, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTTCTGAGTGGGGCACTATGCTTCCGAATGAAGGATTCAGCCTTGAAGGTACTGTATCTGCACAATA
  ACCAGCTGCTGGCTGGAGGACTGCACGCAGAGAAGGTCATTAAAGGTGAGGAGATCAGTGTTGTCCCAAA
  TCGGGCACTGGATGCCAGTCTGTCCCCTGTCATCCTGGGCGTTCAAGGAGGAAGCCAGTGCCTATCTTGT
  GGGACAGAGAAAGGGCCAATTCTGAAACTTGAGCCAGTGAACATCATGGAGCTCTACCTCGGGGCCAAGG
  AATCAAAGAGCTTCACCTTCTACCGGCGGGATATGGGTCTTACCTCCAGCTTCGAATCCGCTGCCTACCC
  AGGCTGGTTCCTCTGCACCTCACCGGAAGCTGACCAGCCTGTCAGGCTCACTCAGATCCCTGAGGACCCC
  GCCTGGGATGCTCCCATCACAGACTTCTACTTTCAGCAGTGTGACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001146087
• ORF Size: 468 bp
• Insert Size: 468
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC132600, AAI32601
• RefSeq Size: 719
• RefSeq ORF: 471
• Locus ID: 54450