Npff (NM_018787) Mouse Untagged Clone

CAT#: MC209987

Npff (untagged) - Mouse neuropeptide FF-amide peptide precursor (Npff), transcript variant 1, (10ug)


  "NM_018787" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Npff"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Npff
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209987 representing NM_018787
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACTCCAAGTGGGCTGCTCTGCTGCTGCTGCTACTGCTGCTGCTGAATTGGGGCCACACTGAAGAGG
CAGGGAGCTGGGGTGAAGACCAAGTCTTTGCAGGAGAAGATAAGGGACCCCACCCACCACAGTATGCCCA
CATTCCAGACAGGATCCAGACTCCTGGGTCCCTCTTTCGTGTTCTGCTCCAGGCCATGGACACACCTAGA
AGGAGCCCAGCCTTCCTGTTTCAGCCCCAGAGGTTTGGCAGAAGTGCATGGGGGTCCTGGAGCAAGGAAC
AGCTAAATCCGCAGGCCAGACAGTTCTGGAGCCTGGCCGCTCCTCAGCGCTTTGGGAAGAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_018787
ORF Size 345 bp
Insert Size 345
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_018787.1, NP_061257.1
RefSeq Size 451
RefSeq ORF 345
Locus ID 54615
Gene Summary This gene encodes neuropeptides involved in analgesia, cardiovascular regulation, neuroendocrine function and opiate addiction. The encoded protein is a preproprotein that undergoes further processing to generate multiple amidated peptides. [provided by RefSeq, Jul 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.