Cldn18 (NM_001194923) Mouse Untagged Clone

CAT#: MC210063

Cldn18 (untagged) - Mouse claudin 18 (Cldn18), transcript variant A2.2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cldn18
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210063 representing NM_001194923
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCGGTGACCGCCTGCCAGGGCTTGGGGTTTGTGGTGTCACTGATCGGGTTTGCGGGCATCATTGCAG
  CCACTTGTATGGACCAGTGGAGCACCCAGGATTTATACAACAACCCGGTGACCGCTGTATTCAACTACCA
  AGGGCTATGGCGTTCATGCGTCCGAGAGAGCTCTGGCTTCACCGAGTGCCGAGGCTACTTCACCCTGTTG
  GGGTTGCCAGCCATGCTGCAAGCTGTACGAGCCCTGATGATCGTGGGCATTGTTCTGGGGGTCATCGGTA
  TCCTCGTGTCCATCTTCGCCCTGAAGTGCATTCGCATTGGTAGCATGGATGACTCTGCCAAGGCCAAGAT
  GACTCTGACTTCTGGGATCTTGTTCATCATCTCCGGCATCTGTGCAATCATTGGTGTGTCTGTGTTTGCC
  AACATGCTGGTGACCAACTTCTGGATGTCCACAGCTAACATGTACAGCGGCATGGGCGGCATGGGTGGCA
  TGGTGCAGACCGTTCAGACCAGGTACACCTTTGGTGCAGCTCTGTTCGTGGGCTGGGTTGCTGGAGGCCT
  CACCCTGATTGGGGGAGTGATGATGTGCATCGCCTGCCGTGGCCTGACACCAGATGACAGCAAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001194923
• ORF Size: 627 bp
• Insert Size: 627
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001194923.1, NP_001181852.1
• RefSeq Size: 2786
• RefSeq ORF: 627
• Locus ID: 56492
• Gene Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is a downstream target gene regulated by the T/EBP/NKX2.1 homeodomain transcription factor. Four alternatively spliced transcript variants resulted from alternative promoters and alternative splicing have been identified, which encode two lung-specific isoforms and two stomach-specific isoforms respectively. This gene is also expressed in colons, inner ear and skin, and its expression is increased in both experimental colitis and ulcerative colitis. [provided by RefSeq, Aug 2010]
  Transcript Variant: This variant (A2.2) is the stomach-specific form. It has an alternate 5' exon, and an additional segment in the CDS, which results in an immediate translation termination, as compared to variant A1.1. The resulting isoform (A2.2) has a different N-terminus and is C-terminal truncated, as compared to isoform A1.1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.