Tbata (NM_023064) Mouse Untagged Clone

CAT#: MC210245

Tbata (untagged) - Mouse thymus, brain and testes associated (Tbata), transcript variant 3, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tbata
• Synonyms: 1700021K02Rik; AI428928; Spatial; Titest
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210245 representing NM_023064
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  CTGTTTCTGGGGAATGTATATAAGGGGAGTTTAGCACCTCGTAGGGATGAGGTGACTAGTCCAAAGGCAG
  AGCCCCAGCCAGAGACGAAGCCGGAGAACCTTCCAAGGAGCCACGGGGATGTTGGGCTCCAGAAAGAGAC
  TGTGGTCCCAGGCATTGTGGATTTCGAGCTGATCCATGAGGAGCTGAAGACCACAAAGCCCCAAACATCA
  CAACCAACACCCAGTGCCTACCGCTTTGGACGCCTAAGCCACCATTCCTTCTTCTCGAGGCACCACCCCC
  AACCACAGCGAGTGACTCATATCCAAGTTACAGGAAGAGAGGACCTGGAGCACTCCCTGCCCCTCACCAC
  CTCTTTCCAGCTCCTTCAAGCTCCTGGGGTCCAGCCCATGGATCTCACTCCCTCTGCAGATATCGCTGGG
  AAGCCTGTCTGCGTGGTCAGGGACGAGTTCTCTCTGTCGGCCTTGACTCAGCCCACATTCTTATCCCGCT
  GTCTGATGGGGATGCCCACCATCTCTGTCCCCATTGGGGATCCACAGTCCAATCGGAACCCCCAGCTTTC
  TACTTCTGACACCTGGAGGAAGAAACTGAAGGACCTGGCTTCCCGAGTGACTGTCTTCACTAAGGAAATC
  CAGCCAAAGCCCGATGAGGTTGGTGTTGCACAAAGAATGGAGCCTAGAAAAAAAAGGCCTTCTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_023064
• ORF Size: 696 bp
• Insert Size: 696
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_023064.3, NP_075551.3
• RefSeq Size: 1034
• RefSeq ORF: 696
• Locus ID: 65971
• Gene Summary: This gene encodes a putative transcription factor that is highly expressed in thymic cortical stromal cells, and may be involved in T-cell development. Its expression is developmentally regulated in the testis, where it is restricted to the haploid round spermatids during spermatogenesis, and thus this gene may also have a role in the control of male germ cell development. Alternative splicing of this gene results in two sets of transcript variants: the variants containing 5 additional exons at the 3' end encode long isoforms that are highly expressed in the testis, while the variants lacking the 3' end exons encode short isoforms that are highly expressed in the thymus. Most of the transcripts encoding the short isoforms have been shown to initiate translation from non-AUG (CUG) start sites. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) encodes the longest of the short isoforms (3, also known as Spatial-alpha). It initiates translation from a non-AUG (CUG) start site and is highly expressed in the thymus.