Tbata (NM_001017407) Mouse Untagged Clone
CAT#: MC210249
Tbata (untagged) - Mouse thymus, brain and testes associated (Tbata), transcript variant 5, (10ug)
"NM_001017407" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Tbata |
Synonyms | 1700021K02Rik; AI428928; Spatial; Titest |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210249 representing NM_001017407
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC CTGTTTCTGGGGAATGTATATAAGGGGAGTTTAGCACCTCGTAGGGATGAGGTGACTAGTCCAAAGGCAG AGCCCCAGCCAGAGACGAAGCCGGAGAACCTTCCAAGGAGCCACGGGGATGTTGGGCTCCAGAAAGAGAC TGTGGTCCCAGGCATTGTGGATTTCGAGCTGATCCATGAGGAGCTGAAGACCACAAAGCCCCAAACATCA CAACCAACACCCAGTGCCTACCGCTTTGGACGCCTAAGCCACCATTCCTTCTTCTCGAGGCACCACCCCC AACCACAGCGAGTGACTCATATCCAAGATATCGCTGGGAAGCCTGTCTGCGTGGTCAGGGACGAGTTCTC TCTGTCGGCCTTGACTCAGCCCACATTCTTATCCCGCTGTCTGATGGGGATGCCCACCATCTCTGTCCCC ATTGGGGATCCACAGTCCAATCGGAACCCCCAGCTTTCTACTTCTGACACCTGGAGGAAGAAACTGAAGG ACCTGGCTTCCCGAGTGACTGTCTTCACTAAGGAAATCCAGCCAAAGCCCGATGAGGTTGGTGTTGCACA AAGAATGGAGCCTAGAAAAAAAAGGCCTTCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001017407 |
Insert Size | 594 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001017407.1, NP_001017407.1 |
RefSeq Size | 932 bp |
RefSeq ORF | 594 bp |
Locus ID | 65971 |
Cytogenetics | 10 B4 |
Gene Summary | This gene encodes a putative transcription factor that is highly expressed in thymic cortical stromal cells, and may be involved in T-cell development. Its expression is developmentally regulated in the testis, where it is restricted to the haploid round spermatids during spermatogenesis, and thus this gene may also have a role in the control of male germ cell development. Alternative splicing of this gene results in two sets of transcript variants: the variants containing 5 additional exons at the 3' end encode long isoforms that are highly expressed in the testis, while the variants lacking the 3' end exons encode short isoforms that are highly expressed in the thymus. Most of the transcripts encoding the short isoforms have been shown to initiate translation from non-AUG (CUG) start sites. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (5) uses an alternate, in-frame acceptor splice site in one of the coding exons compared to transcript variant 3, resulting in an isoform (5, also known as Spatial-gamma) that is missing an internal segment compared to short isoform 3. This variant initiates translation from a non-AUG (CUG) start site and is highly expressed in the thymus. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR223431 | Tbata (Myc-DDK-tagged) - Mouse thymus, brain and testes associated (Tbata), transcript variant 5 |
USD 210.00 |
|
MG223431 | Tbata (GFP-tagged) - Mouse thymus brain and testes associated (Tbata) transcript variant 5, (10ug) |
USD 230.00 |
|
MR223431L3 | Lenti ORF clone of Tbata (Myc-DDK-tagged) - Mouse thymus, brain and testes associated (Tbata), transcript variant 5 |
USD 410.00 |
|
MR223431L4 | Lenti ORF clone of Tbata (mGFP-tagged) - Mouse thymus, brain and testes associated (Tbata), transcript variant 5 |
USD 410.00 |
{0} Product Review(s)
Be the first one to submit a review