Tbata (NM_001017419) Mouse Untagged Clone

CAT#: MC210250

Tbata (untagged) - Mouse thymus, brain and testes associated (Tbata), transcript variant 2, (10ug)


  "NM_001017419" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Tbata"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tbata
Synonyms 1700021K02Rik; AI428928; Spatial; Titest
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210250 representing NM_001017419
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACTACAGAGGTGAACCAGCTGTCTGAGCATCCTCTAGTGAGTCCAAAGGCAGAGCCCCAGCCAGAGA
CGAAGCCGGAGAACCTTCCAAGGAGCCACGGGGATGTTGGGCTCCAGAAAGAGACTGTGGTCCCAGGCAT
TGTGGATTTCGAGCTGATCCATGAGGAGCTGAAGACCACAAAGCCCCAAACATCACAACCAACACCCAGT
GCCTACCGCTTTGGACGCCTAAGCCACCATTCCTTCTTCTCGAGGCACCACCCCCAACCACAGCGAGTGA
CTCATATCCAAGATATCGCTGGGAAGCCTGTCTGCGTGGTCAGGGACGAGTTCTCTCTGTCGGCCTTGAC
TCAGCCCACATTCTTATCCCGCTGTCTGATGGGGATGCCCACCATCTCTGTCCCCATTGGGGATCCACAG
TCCAATCGGAACCCCCAGCTTTCTACTTCTGACACCTGGAGGAAGAAACTGAAGGACCTGGCTTCCCGAG
TGACTGTCTTCACTAAGGAAATCCAGCCAAAGCCCGATGAGCAGAAGGAAGAGCCACCTCTGAGGGAACC
TCCTCCGAGAGAGCAGGGGGCCAAATACTCAGCTGAGACCGGTAGGCTTATCCCTGCTTCCAGCCAAGCC
CTCACCCGTCGCAACCGCCAGGGCCAGCGGGTCCACCCTTCTAGCAAAGATGGAGGAGTCCAAGCCTCCA
TTCTGCAGGACCAGGAGCTGCTGATTTTGGAGCTCCTTTGTCAAATTCTACAAACAGATTCTCTAAGGGC
TATTCAGTTCTGGCTGCTTTATGCTCCATCAAAAGAAAAAGATTTAGCTCTGGGGCTTCTGCAAACTGCC
GTGGCTCAGCTTATCCCCCAGCCCCTTTCCTCCATCCCAGCAGAGAAGCTCTGGAACCATCTCCAAGAGC
TTCAAGAGCCTCAAGAGACACAAGAGGCAGCCTACAGTCCATCCCTGAAGAAGACTAGGTCACCACCTCT
ACCCAAAACAGACAAACCAGAGTACATAGGCAAAGCCCAAGTCCTCCTGGTGCATCCCAGCGAGGACCCA
GAGGAGAAAACGACCAAGGCTGAAAGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001017419
Insert Size 1080 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001017419.2, NP_001017419.1
RefSeq Size 1443 bp
RefSeq ORF 1080 bp
Locus ID 65971
Cytogenetics 10 B4
Gene Summary This gene encodes a putative transcription factor that is highly expressed in thymic cortical stromal cells, and may be involved in T-cell development. Its expression is developmentally regulated in the testis, where it is restricted to the haploid round spermatids during spermatogenesis, and thus this gene may also have a role in the control of male germ cell development. Alternative splicing of this gene results in two sets of transcript variants: the variants containing 5 additional exons at the 3' end encode long isoforms that are highly expressed in the testis, while the variants lacking the 3' end exons encode short isoforms that are highly expressed in the thymus. Most of the transcripts encoding the short isoforms have been shown to initiate translation from non-AUG (CUG) start sites. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate, in-frame acceptor splice site in one of the coding exons compared to transcript variant 1, resulting in an isoform (2, also known as Spatial-delta) that is missing an internal segment compared to long isoform 1, and like the latter, it is highly expressed in the testis.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.