S100a14 (NM_001163526) Mouse Untagged Clone

CAT#: MC210291

S100a14 (untagged) - Mouse S100 calcium binding protein A14 (S100a14), transcript variant 3, (10ug)


  "NM_001163526" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "S100a14"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol S100a14
Synonyms 1110013O05Rik; S100a15; S114
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210291 representing NM_001163526
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGACAGTGTCGGTCAGCCAATGCTGAGAGCAACTGTGGGTTAGAAGAGAAAATTGCCAACCTGGGCA
ACTGTAATGACTCGAAACTGGAGTTTGGAAGCTTCTGGGAGTTGATTGGAGAAGCAGCCAAGAGTGTGAA
GATGGAGAGGCCTGTTACTCGGAGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001163526
ORF Size 168 bp
Insert Size 168
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001163526.2, NP_001156998.1
RefSeq Size 933
RefSeq ORF 168
Locus ID 66166

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.