Mustn1 (NM_181390) Mouse Untagged Clone

CAT#: MC210293

Mustn1 (untagged) - Mouse musculoskeletal, embryonic nuclear protein 1 (Mustn1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Mustn1
• Synonyms: 1110028G01Rik; Mustang
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181390, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCGAGGCTGGCACTCCTGAAGGCCCCATCAAGAAGAAGCGGCCCCCTGTGAAGGAAGAAGACCTGA
  AGGGGGCCCGAGGGACCCTGGCCAAGAACCAGGACATCAAGTCTAAGACATACCAGGTCATGCGGGACTA
  CGAGCAAGCCGGCTCAGCTGCCCCATCTGTATTCAGCCGCAACCGCACAGGCACCGAGACAGTCTTTGAG
  AAGCCCAAAGAGGGACCAGCCAAGAGCGTGTTTGGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_181390
• ORF Size: 249 bp
• Insert Size: 249
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC116941, AAI16942
• RefSeq Size: 627
• RefSeq ORF: 249
• Locus ID: 66175