Cks2 (NM_025415) Mouse Untagged Clone

CAT#: MC210298

Cks2 (untagged) - Mouse CDC28 protein kinase regulatory subunit 2 (Cks2), (10ug)


  "NM_025415" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cks2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cks2
Synonyms 1110038L14Rik; CKSHS2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210298 representing NM_025415
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCACAAGCAGATCTACTACTCAGACAAGTACTTCGATGAGCACTACGAGTACCGGCATGTCATGT
TACCCAGAGAACTCTCTAAACAAGTACCCAAAACTCATCTGATGTCCGAAGAGGAGTGGAGGAGACTTGG
TGTCCAACAGAGTCTAGGATGGGTTCATTACATGATTCATGAGCCAGAACCGCATATTCTTCTCTTTAGA
CGACCTCTTCCAAAAGAACAACAAAAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_025415
ORF Size 240 bp
Insert Size 240
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_025415.3, NP_079691.1
RefSeq Size 694
RefSeq ORF 240
Locus ID 66197
Gene Summary Binds to the catalytic subunit of the cyclin dependent kinases and is essential for their biological function. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.