Dynlrb1 (NM_025947) Mouse Untagged Clone

CAT#: MC210480

Dynlrb1 (untagged) - Mouse dynein light chain roadblock-type 1 (Dynlrb1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dynlrb1
• Synonyms: 2010012N15Rik; 2010320M17Rik; 9430076K19Rik; AV124457; Dncl2a; DNLC2A; km23-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210480 representing NM_025947
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCAGAGGTGGAGGAAACACTCAAGAGGCTTCAGAGCCAGAAAGGAGTGCAGGGCATCATCGTGGTGA
  ACACAGAAGGCATTCCCATCAAGAGCACAATGGACAATCCCACCACTACACAGTATGCCAACCTCATGCA
  CAACTTCATCTTGAAGGCGCGGAGCACTGTGCGTGAGATTGACCCCCAAAACGACCTAACCTTCCTTCGA
  ATTCGCTCCAAGAAAAATGAAATTATGGTGGCACCAGATAAAGACTATTTCCTGATTGTGATCCAGAATC
  CAACTGAATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_025947
• ORF Size: 291 bp
• Insert Size: 291
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_025947.3, NP_080223.2
• RefSeq Size: 702
• RefSeq ORF: 291
• Locus ID: 67068
• Gene Summary: Acts as one of several non-catalytic accessory components of the cytoplasmic dynein 1 complex that are thought to be involved in linking dynein to cargos and to adapter proteins that regulate dynein function. Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) contains an alternate 5' terminal exon, and it thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a.