Snrpd3 (NM_026095) Mouse Untagged Clone

CAT#: MC210523

Snrpd3 (untagged) - Mouse small nuclear ribonucleoprotein D3 (Snrpd3), (10ug)


  "NM_026095" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Snrpd3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Snrpd3
Synonyms 1700043E15Rik; 2310009E13Rik; AW046420; SMD3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210523 representing NM_026095
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTATTGGTGTGCCGATTAAAGTCTTGCACGAGGCTGAAGGCCACATAGTGACGTGTGAGACCAACA
CCGGGGAAGTATACCGAGGGAAGCTCATTGAAGCAGAGGACAACATGAACTGTCAGATGTCCAACATCAC
AGTCACATACAGAGATGGTCGAGTGGCACAGCTGGAACAGGTATATATACGTGGCAGCAAGATCCGATTT
CTGATTTTGCCTGACATGCTGAAAAATGCACCCATGTTAAAGAGCATGAAAAATAAAAACCAAGGCTCAG
GGGCCGGCAGAGGAAAAGCTGCTATCCTGAAGGCCCAAGTGGCCGCACGAGGGAGAGGACGTGGGATGGG
ACGTGGGAACATCTTCCAGAAGCGAAGATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_026095
ORF Size 381 bp
Insert Size 381
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_026095.4, NP_080371.1
RefSeq Size 604
RefSeq ORF 381
Locus ID 67332
Gene Summary Core component of the spliceosomal U1, U2, U4 and U5 small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome. Thereby, plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in a heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP. As part of the U7 snRNP it is involved in histone 3'-end processing. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.