Ost4 (NM_024460) Mouse Untagged Clone

CAT#: MC210601

Ost4 (untagged) - Mouse oligosaccharyltransferase 4 homolog (S. cerevisiae) (Ost4), transcript variant 1, (10ug)


  "NM_024460" in other vectors (5)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ost4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ost4
Synonyms 2310016E02Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210601 representing NM_024460
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATCACGGACGTGCAGCTCGCCATCTTCGCCAACATGCTGGGCGTGTCGCTTTTCTTGCTTGTGGTCC
TCTATCACTACGTGGCAGTAAACAACCCCAAGAAGCAGGAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_024460
ORF Size 114 bp
Insert Size 114
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_024460.4, NP_077780.3
RefSeq Size 529
RefSeq ORF 114
Locus ID 67695

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.